The Full Wiki

Haplogroup Q (Y-DNA): Map

Advertisements
  
  
  

Wikipedia article:

Map showing all locations mentioned on Wikipedia article:



In human genetics, Haplogroup Q (M242) is a Y-chromosome DNA haplogroup.

Haplogroup Q is a branch of haplogroup P (M45). It is believed to have arisen in Siberiamarker approximately 15,000 to 20,000 years ago.

This haplogroup contains many Siberians, Central Asians, and indigenous peoples of the Americas. Haplogroup Q Y-chromosomes are also found scattered at a low frequency throughout Eurasia. This haplogroup is diverse despite its low frequency among most populations outside of Siberia or the Americas, and at least six primary subclades have been sampled and identified in modern populations.

Distribution

In the Old World, the Q lineage and its many branches is largely found within a huge triangle defined by Norwaymarker in the northwest, the Iranian plateau in the south, and northern Chinamarker in the east, northeastern Europe and central Asia being bound by this triangle. Haplogroup Q also has been detected in Yemenite Jews, Algerians, Arabians, Lebanese, Turks, Indians, Sri Lankans, Nepalese, Tibetans, Vietnamese, southern Chinese, Koreans, and Japanese. The frequency of Q in Norway and northern China is about 4%, with Chinese samples of haplogroup Q belonging almost exclusively to the subclade Q1a1-M120. 3% of Hungarian males are in haplogroup Q; it is believed this was a modal haplogroup of either the Huns, ancient Magyars or both. In Iran, the frequency runs between approximately 2.6% in the south and 9.1% in the north; Iranian samples of haplogroup Q belong almost exclusively to the subclade Q1a2-M25. In Pakistanmarker, at the eastern end of the Iranian plateau, the frequency of haplogroup Q is about 2.2% (14/638) or 3.4% (6/176). Haplogroup Q has been found in approximately 4% of Southern Altaians and 32% of Northern Altaians, 16% of Tuvans, and 3% of Uyghurs, all of which are Turkic peoples inhabiting parts of Central Asia and southern Siberia. Haplogroup Q is found in approximately 3% of males in Tibet and Mongoliamarker, approximately 2.5% of males in Saudi Arabiamarker, and approximately 2% of males in Turkeymarker, Lebanonmarker, and the United Arab Emiratesmarker. Only two groups in the Old World are majority Q groups. These are the Selkups (~70%) and Kets (~95%). They live in western and middle Siberiamarker and are small in number, being just under 5,000 and 1,500, respectively.

In a most recent study Gokcumen finds that among Turks that belong to the Afshar tribe haplogroup Q is seen with a prevalence of 13%.

Subclade Q1a3a (Q3)

A migration from Asia into Alaska across the Bering Strait was done by haplogroup Q populations approximately 20,000 to 15,000 years ago. This founding population spread throughout the Americas. In the Americas, a member of the founding population underwent a mutation, producing its descendant population defined by the M3 single nucleotide polymorphism (SNP).

Discovery of ancestral Q in the Indian subcontinent

A Biomed study observed an ancestral state Q* and a novel sub-branch Q5, not reported elsewhere, in the Indian subcontinent, though in low frequency. A novel subgroup Q4 was identified recently which is also restricted to the Indian subcontinent. The most plausible explanation for these observations could be an ancestral migration of individuals bearing ancestral lineage Q* to the Indian subcontinent followed by an autochthonous differentiation to Q4 and Q5 sublineages later on. Thus the subcontinent has three novel Q lineages, an ancestral Q* (different from the Central Asian Q*), Q4 and Q5 unique to the subcontinent.However, the recent ISOGG tree lacks the representation of Q5 (defined by ss4 bp, rs41352448) . Haplogroup Q4 is shown as Q1a3 (defined by M346) in the recent ISOGG tree. Taking the relationship of Q4 (M346) and Q5 (ss4bp) into consideration, Q5 may be positioned as Q1a7.

Technical specification of mutation

The technical details of M242 are:

Nucleotide change: C to T
Position (base pair): 180
Total size (base pairs): 366
Forward 5′→ 3′: aactcttgataaaccgtgctg
Reverse 5′→ 3′: tccaatctcaattcatgcctc


Subgroups

The subclades of Haplogroup Q with their defining mutation(s), according to the 2008 ISOGG tree are provided below. Subclade Q1a7 (ss4 bp, rs41352448) is not represented in the ISOGG 2008 tree because it is a value for an STR. This low frequency value been found as a novel Q lineage (Q5) in indian populations.

The 2008 ISOGG tree



See also





    • Q1a3a (The only Y Chromosome haplogroup strictly associated with the indigenous peoples of the Americas.)
  • Paleo-Indians


References

  1. Bing Su, Chunjie Xiao, Ranjan Deka et al., "Y chromosome haplotypes reveal prehistorical migrations to the Himalayas," Human Genetics (2000) 107 : 582–590. DOI 10.1007/s004390000406
  2. Sadaf Firasat, Shagufta Khaliq, Aisha Mohyuddin, Myrto Papaioannou, Chris Tyler-Smith, Peter A Underhill and Qasim Ayub: "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan." European Journal of Human Genetics (2007) Vol. 15, p. 121–126.
  3. V. N. Kharkov, V. A. Stepanov, O. F. Medvedeva, M. G. Spiridonova, M. I. Voevoda, V. N. Tadinova, and V. P. Puzyrev, "Gene Pool Differences between Northern and Southern Altaians Inferred from the Data on Y-Chromosomal Haplogroups," Genetika (2007), Vol. 43, No. 5, pp. 675–687.
  4. Brigitte Pakendorf, Innokentij N. Novgorodov, Vladimir L. Osakovskij et al., "Investigating the effects of prehistoric migrations in Siberia: genetic variation and the origins of Yakuts," Human Genetics (2006) 120:334–353 DOI 10.1007/s00439-006-0213-2
  5. Hammer et al., "Dual origins of the Japanese: common ground for hunter-gatherer and farmer Y chromosomes," © The Japan Society of Human Genetics, Springer-Verlag (2005)
  6. Khaled K. Abu-Amero, Ali Hellani, Ana M. Gonzalez et al., "Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions," BMC Genetics 2009, 10:59 doi:10.1186/1471-2156-10-59
  7. http://proquest.umi.com/pqdlink?Ver=1&Exp=05-24-2014&FMT=7&DID=1601911211&RQT=309&attempt=1
  8. Sanghamitra Sengupta, Lev A. Zhivotovsky, Roy King, S.Q. Mehdi, Christopher A. Edmonds, Cheryl-Emiliane T. Chow, Alice A. Lin, Mitashree Mitra, Samir K. Sil, A. Ramesh, M.V. Usha Rani, Chitra M. Thakur, L. Luca Cavalli-Sforza, Partha P. Majumder, and Peter A. Underhill, "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists," The American Journal of Human Genetics, Volume 78, Issue 2, 202-221, 1 February 2006.
  9. I. Nonaka, K. Minaguchi, and N. Takezaki, "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms," Annals of Human Genetics Volume 71 Issue 4, Pages 480 - 495 (July 2007).
  10. Pierre A. Zalloua et al., "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events," American Journal of Human Genetics 82, 873–882, April 2008.
  11. Peidong Shen, Tal Lavi, Toomas Kivisild, Vivian Chou, Deniz Sengun, Dov Gefel, Issac Shpirer, Eilon Woolf, Jossi Hillel, Marcus W. Feldman, and Peter J. Oefner, "Reconstruction of Patrilineages and Matrilineages of Samaritans and Other Israeli Populations From Y-Chromosome and Mitochondrial DNA Sequence Variation," Human Mutation 24:248-260 (2004). Q-M323 in 3/20 = 15% of a sample of Yemenite Jews.
  12. http://www.familytreedna.com/public/AshinaRoyalDynasty/default.aspx?section=results
  13. Sanghamitra Sengupta, Lev A. Zhivotovsky, Roy King, S.Q. Mehdi, Christopher A. Edmonds, Cheryl-Emiliane T. Chow, Alice A. Lin, Mitashree Mitra, Samir K. Sil, A. Ramesh, M.V. Usha Rani, Chitra M. Thakur, L. Luca Cavalli-Sforza, Partha P. Majumder, and Peter A. Underhill, "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists," The American Journal of Human Genetics, Volume 78, Issue 2, 202-221, 1 February 2006.


External links




Embed code:
Advertisements






Got something to say? Make a comment.
Your name
Your email address
Message